First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm

Studies in zebrafish (Danio rerio)

Sohye Yoon, Suman Mitra, Cathy Wyse, Ayham Alnabulsi, Jun Zou, Eveline M. Weerdenburg, Astrid van der Sar, Difei Wang, Christopher J. Secombes, Steve Bird

Research output: Contribution to journalArticle

33 Citations (Scopus)
4 Downloads (Pure)

Abstract

Adaptive immunity in homeotherms depends greatly on CD4+ Th cells which release cytokines in response to specific antigen stimulation. Whilst bony fish and poikilothermic tetrapods possess cells that express TcR and CD4-related genes (that exist in two forms in teleost fish; termed CD4-1 and CD4-2), to date there is no unequivocal demonstration that cells equivalent to Th exist. Thus, in this study we determined whether CD4-1+ lymphocytes can express cytokines typical of Th cells following antigen specific stimulation, using the zebrafish (Danio rerio). Initially, we analyzed the CD4 locus in zebrafish and found three CD4 homologues, a CD4-1 molecule and two CD4-2 molecules. The zfCD4-1 and zfCD4-2 transcripts were detected in immune organs and were most highly expressed in lymphocytes. A polyclonal antibody to zfCD4-1 was developed and used with an antibody to ZAP70 and revealed double positive cells by immunohistochemistry, and in the Mycobacterium marinum disease model CD4-1+ cells were apparent surrounding the granulomas typical of the infection. Next a prime-boost experiment, using human gamma globulin as antigen, was performed and revealed for the first time in fish that zfCD4-1+ lymphocytes increase the expression of cytokines and master transcription factors relevant to Th1/Th2-type responses as a consequence of boosting with specific antigen.
Original languageEnglish
Article number0126378
Number of pages26
JournalPloS ONE
Volume10
Issue number6
Early online date17 Jun 2015
DOIs
Publication statusPublished - 17 Jun 2015

Fingerprint

Lymphocytes
Zebrafish
Danio rerio
cytokines
Demonstrations
lymphocytes
Fish
Cytokines
antigens
Antigens
CD4 Antigens
Fishes
cells
Molecules
Antibodies
gamma-Globulins
Mycobacterium marinum
gamma-globulins
Transcription Factors
disease models

Cite this

First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm : Studies in zebrafish (Danio rerio). / Yoon, Sohye; Mitra, Suman; Wyse, Cathy; Alnabulsi, Ayham; Zou, Jun; Weerdenburg, Eveline M.; van der Sar, Astrid; Wang, Difei; Secombes, Christopher J.; Bird, Steve.

In: PloS ONE, Vol. 10, No. 6, 0126378, 17.06.2015.

Research output: Contribution to journalArticle

Yoon, Sohye ; Mitra, Suman ; Wyse, Cathy ; Alnabulsi, Ayham ; Zou, Jun ; Weerdenburg, Eveline M. ; van der Sar, Astrid ; Wang, Difei ; Secombes, Christopher J. ; Bird, Steve. / First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm : Studies in zebrafish (Danio rerio). In: PloS ONE. 2015 ; Vol. 10, No. 6.
@article{1d2659f5528145d4847b446ecb43ec7b,
title = "First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm: Studies in zebrafish (Danio rerio)",
abstract = "Adaptive immunity in homeotherms depends greatly on CD4+ Th cells which release cytokines in response to specific antigen stimulation. Whilst bony fish and poikilothermic tetrapods possess cells that express TcR and CD4-related genes (that exist in two forms in teleost fish; termed CD4-1 and CD4-2), to date there is no unequivocal demonstration that cells equivalent to Th exist. Thus, in this study we determined whether CD4-1+ lymphocytes can express cytokines typical of Th cells following antigen specific stimulation, using the zebrafish (Danio rerio). Initially, we analyzed the CD4 locus in zebrafish and found three CD4 homologues, a CD4-1 molecule and two CD4-2 molecules. The zfCD4-1 and zfCD4-2 transcripts were detected in immune organs and were most highly expressed in lymphocytes. A polyclonal antibody to zfCD4-1 was developed and used with an antibody to ZAP70 and revealed double positive cells by immunohistochemistry, and in the Mycobacterium marinum disease model CD4-1+ cells were apparent surrounding the granulomas typical of the infection. Next a prime-boost experiment, using human gamma globulin as antigen, was performed and revealed for the first time in fish that zfCD4-1+ lymphocytes increase the expression of cytokines and master transcription factors relevant to Th1/Th2-type responses as a consequence of boosting with specific antigen.",
author = "Sohye Yoon and Suman Mitra and Cathy Wyse and Ayham Alnabulsi and Jun Zou and Weerdenburg, {Eveline M.} and {van der Sar}, Astrid and Difei Wang and Secombes, {Christopher J.} and Steve Bird",
note = "Acknowledgments Both first authors were supported by the Scottish Overseas Research Scholarship Awards Scheme (SORSAS) to undertake a PhD program at the University of Aberdeen. Correction: First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio) Sohye Yoon, Suman Mitra, Cathy Wyse, Ayham Alnabulsi, Jun Zou, Eveline M. Weerdenburg, Astrid M. van der Sar, Difei Wang, Christopher J. Secombes, Steve Bird Published: December 21, 2016 http://dx.doi.org/10.1371/journal.pone.0169149 The CD4-1-R primer sequence is listed incorrectly in S2 Table. The correct primer sequence is: 5'CTGGTCGGTCTTAAATGAAACT3'.",
year = "2015",
month = "6",
day = "17",
doi = "10.1371/journal.pone.0126378",
language = "English",
volume = "10",
journal = "PloS ONE",
issn = "1932-6203",
publisher = "PUBLIC LIBRARY SCIENCE",
number = "6",

}

TY - JOUR

T1 - First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm

T2 - Studies in zebrafish (Danio rerio)

AU - Yoon, Sohye

AU - Mitra, Suman

AU - Wyse, Cathy

AU - Alnabulsi, Ayham

AU - Zou, Jun

AU - Weerdenburg, Eveline M.

AU - van der Sar, Astrid

AU - Wang, Difei

AU - Secombes, Christopher J.

AU - Bird, Steve

N1 - Acknowledgments Both first authors were supported by the Scottish Overseas Research Scholarship Awards Scheme (SORSAS) to undertake a PhD program at the University of Aberdeen. Correction: First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio) Sohye Yoon, Suman Mitra, Cathy Wyse, Ayham Alnabulsi, Jun Zou, Eveline M. Weerdenburg, Astrid M. van der Sar, Difei Wang, Christopher J. Secombes, Steve Bird Published: December 21, 2016 http://dx.doi.org/10.1371/journal.pone.0169149 The CD4-1-R primer sequence is listed incorrectly in S2 Table. The correct primer sequence is: 5'CTGGTCGGTCTTAAATGAAACT3'.

PY - 2015/6/17

Y1 - 2015/6/17

N2 - Adaptive immunity in homeotherms depends greatly on CD4+ Th cells which release cytokines in response to specific antigen stimulation. Whilst bony fish and poikilothermic tetrapods possess cells that express TcR and CD4-related genes (that exist in two forms in teleost fish; termed CD4-1 and CD4-2), to date there is no unequivocal demonstration that cells equivalent to Th exist. Thus, in this study we determined whether CD4-1+ lymphocytes can express cytokines typical of Th cells following antigen specific stimulation, using the zebrafish (Danio rerio). Initially, we analyzed the CD4 locus in zebrafish and found three CD4 homologues, a CD4-1 molecule and two CD4-2 molecules. The zfCD4-1 and zfCD4-2 transcripts were detected in immune organs and were most highly expressed in lymphocytes. A polyclonal antibody to zfCD4-1 was developed and used with an antibody to ZAP70 and revealed double positive cells by immunohistochemistry, and in the Mycobacterium marinum disease model CD4-1+ cells were apparent surrounding the granulomas typical of the infection. Next a prime-boost experiment, using human gamma globulin as antigen, was performed and revealed for the first time in fish that zfCD4-1+ lymphocytes increase the expression of cytokines and master transcription factors relevant to Th1/Th2-type responses as a consequence of boosting with specific antigen.

AB - Adaptive immunity in homeotherms depends greatly on CD4+ Th cells which release cytokines in response to specific antigen stimulation. Whilst bony fish and poikilothermic tetrapods possess cells that express TcR and CD4-related genes (that exist in two forms in teleost fish; termed CD4-1 and CD4-2), to date there is no unequivocal demonstration that cells equivalent to Th exist. Thus, in this study we determined whether CD4-1+ lymphocytes can express cytokines typical of Th cells following antigen specific stimulation, using the zebrafish (Danio rerio). Initially, we analyzed the CD4 locus in zebrafish and found three CD4 homologues, a CD4-1 molecule and two CD4-2 molecules. The zfCD4-1 and zfCD4-2 transcripts were detected in immune organs and were most highly expressed in lymphocytes. A polyclonal antibody to zfCD4-1 was developed and used with an antibody to ZAP70 and revealed double positive cells by immunohistochemistry, and in the Mycobacterium marinum disease model CD4-1+ cells were apparent surrounding the granulomas typical of the infection. Next a prime-boost experiment, using human gamma globulin as antigen, was performed and revealed for the first time in fish that zfCD4-1+ lymphocytes increase the expression of cytokines and master transcription factors relevant to Th1/Th2-type responses as a consequence of boosting with specific antigen.

U2 - 10.1371/journal.pone.0126378

DO - 10.1371/journal.pone.0126378

M3 - Article

VL - 10

JO - PloS ONE

JF - PloS ONE

SN - 1932-6203

IS - 6

M1 - 0126378

ER -