Abstract
Original language | English |
---|---|
Article number | 0126378 |
Number of pages | 26 |
Journal | PloS ONE |
Volume | 10 |
Issue number | 6 |
Early online date | 17 Jun 2015 |
DOIs | |
Publication status | Published - 17 Jun 2015 |
Fingerprint
Cite this
First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm : Studies in zebrafish (Danio rerio). / Yoon, Sohye; Mitra, Suman; Wyse, Cathy; Alnabulsi, Ayham; Zou, Jun; Weerdenburg, Eveline M.; van der Sar, Astrid; Wang, Difei; Secombes, Christopher J.; Bird, Steve.
In: PloS ONE, Vol. 10, No. 6, 0126378, 17.06.2015.Research output: Contribution to journal › Article
}
TY - JOUR
T1 - First demonstration of antigen induced cytokine expression by CD4-1+ lymphocytes in a poikilotherm
T2 - Studies in zebrafish (Danio rerio)
AU - Yoon, Sohye
AU - Mitra, Suman
AU - Wyse, Cathy
AU - Alnabulsi, Ayham
AU - Zou, Jun
AU - Weerdenburg, Eveline M.
AU - van der Sar, Astrid
AU - Wang, Difei
AU - Secombes, Christopher J.
AU - Bird, Steve
N1 - Acknowledgments Both first authors were supported by the Scottish Overseas Research Scholarship Awards Scheme (SORSAS) to undertake a PhD program at the University of Aberdeen. Correction: First Demonstration of Antigen Induced Cytokine Expression by CD4-1+ Lymphocytes in a Poikilotherm: Studies in Zebrafish (Danio rerio) Sohye Yoon, Suman Mitra, Cathy Wyse, Ayham Alnabulsi, Jun Zou, Eveline M. Weerdenburg, Astrid M. van der Sar, Difei Wang, Christopher J. Secombes, Steve Bird Published: December 21, 2016 http://dx.doi.org/10.1371/journal.pone.0169149 The CD4-1-R primer sequence is listed incorrectly in S2 Table. The correct primer sequence is: 5'CTGGTCGGTCTTAAATGAAACT3'.
PY - 2015/6/17
Y1 - 2015/6/17
N2 - Adaptive immunity in homeotherms depends greatly on CD4+ Th cells which release cytokines in response to specific antigen stimulation. Whilst bony fish and poikilothermic tetrapods possess cells that express TcR and CD4-related genes (that exist in two forms in teleost fish; termed CD4-1 and CD4-2), to date there is no unequivocal demonstration that cells equivalent to Th exist. Thus, in this study we determined whether CD4-1+ lymphocytes can express cytokines typical of Th cells following antigen specific stimulation, using the zebrafish (Danio rerio). Initially, we analyzed the CD4 locus in zebrafish and found three CD4 homologues, a CD4-1 molecule and two CD4-2 molecules. The zfCD4-1 and zfCD4-2 transcripts were detected in immune organs and were most highly expressed in lymphocytes. A polyclonal antibody to zfCD4-1 was developed and used with an antibody to ZAP70 and revealed double positive cells by immunohistochemistry, and in the Mycobacterium marinum disease model CD4-1+ cells were apparent surrounding the granulomas typical of the infection. Next a prime-boost experiment, using human gamma globulin as antigen, was performed and revealed for the first time in fish that zfCD4-1+ lymphocytes increase the expression of cytokines and master transcription factors relevant to Th1/Th2-type responses as a consequence of boosting with specific antigen.
AB - Adaptive immunity in homeotherms depends greatly on CD4+ Th cells which release cytokines in response to specific antigen stimulation. Whilst bony fish and poikilothermic tetrapods possess cells that express TcR and CD4-related genes (that exist in two forms in teleost fish; termed CD4-1 and CD4-2), to date there is no unequivocal demonstration that cells equivalent to Th exist. Thus, in this study we determined whether CD4-1+ lymphocytes can express cytokines typical of Th cells following antigen specific stimulation, using the zebrafish (Danio rerio). Initially, we analyzed the CD4 locus in zebrafish and found three CD4 homologues, a CD4-1 molecule and two CD4-2 molecules. The zfCD4-1 and zfCD4-2 transcripts were detected in immune organs and were most highly expressed in lymphocytes. A polyclonal antibody to zfCD4-1 was developed and used with an antibody to ZAP70 and revealed double positive cells by immunohistochemistry, and in the Mycobacterium marinum disease model CD4-1+ cells were apparent surrounding the granulomas typical of the infection. Next a prime-boost experiment, using human gamma globulin as antigen, was performed and revealed for the first time in fish that zfCD4-1+ lymphocytes increase the expression of cytokines and master transcription factors relevant to Th1/Th2-type responses as a consequence of boosting with specific antigen.
U2 - 10.1371/journal.pone.0126378
DO - 10.1371/journal.pone.0126378
M3 - Article
VL - 10
JO - PloS ONE
JF - PloS ONE
SN - 1932-6203
IS - 6
M1 - 0126378
ER -